Human Variation And Race Blog

1. High levels of solar radiation negatively impacts the survival of humans by disturbing homeostasis. If too much ultraviolet radiation hitting one’s skin can cause the breakdown of one of the B vitamins- folate, which may result in anemia. Women who don’t have enough folic acid are at a higher risk of having miscarriages or babies with neural tube defects. Folate is also essential for DNA replication in the process of dividing cells, so a lack of it may result in the reduction of production of sperm cells. Also, the more sunlight children are exposed to, the greater chance they will develop multiple sclerosis. It also obviously causes skin cancer. Having dark skin in northern latitudes can prevent people from producing enough vitamin D and can result in rickets disease in kids and osteoporosis in adults.

2. An example of a short term adaptation humans have to cope with high levels of solar radiation is perspiration. One loses heat through many sweat glands in evaporative cooling. Perspiration is considered to be the "most important factor in heat dissipation" according to the book.

An example of a developmental adaptation is the presence of the pigment called melanin. The number and size of melanin particles as well as the percentages of different kinds of melanin determine skin color. If someone has a higher percentage of pheomelanin their skin will probably be more red to yellow color, and those who have a higher percentage of eumelanin will

probably be more dark brown to black colored

.

An example of a developmental adaption is the presence of the pigment called melanin. The number and size pf melanin particles as well as the percentages of different kinds of melanin determine skin color.If someone has a higher percentage of pheomelanin their skin will probably be more red to yellow color, and those who have a higher percentage of eumelanin will probably be more dark brown to black colored.

Examples of cultural adaptations are sunglasses, hats, clothes and sunscreen. Before people spend a day in the sun, they will usually apply sunscreen to prevent or reduce risk of skin damage and tanning. People also wear sunglasses, hats and extra clothing (beach cover-up) to protect themselves from solar radiation.

3. It is beneficial to study human variations from this perspective across environmental clines because it helps to show why certain people have health problems, or are healthier than others or have the skin tone they do, or why it is beneficial to have the skin tone that they do. By looking at the clines of solar radiation (where melanin is protective) versus clines of solar vitamin D absorption (where melanin is not protective) it shows that in areas where UV protection is needed, skin color is darker, and where people need more vitamin D more than they need UV protection, their skin is lighter. By using UV radiation as a factor in studies like malnutrition among children indicating high frequencies of rickets disease, or vitamin D related to healthy pregnancies, it can be useful to figure out that certain people need more vitamin D, or need to be in the sun less or more to be healthier. In a study published in the Journal of Nutrition, researchers found that prenatal vitamins should contain higher doses of vitamin D, especially in the northern US. 16% of African Americans and 53% of European Americans had enough vitamin D in their bodies at the end of their pregnancies. Therefore, the information that was gathered from UV rays’ connection with vitamin D, and anthropological studies became the basis of further research for human nutrition and pregnancy.

4. Race is influenced by levels of solar radiation, especially in the developmental adaptation of the presence of melanin. Race is the result of the adaptations, especially those that are genetic and longer lasting. Race is the result of different environmental clines and the different makeup of melanin in individuals. It is one of the many adaptations to deal with high levels of solar radiation. The study of environmental influences on adaptations is a better way to understand human variation than by the use of race because race is the result of many different adaptations. These adaptations are what is a key to these major variations and changes in the appearance and makeup of humans. Environmental influences are what must be studied in order to learn about why there is variation among humans, especially skin color. It is interesting to learn why there is variation, because it shows that our bodies are influenced by many simple things that we wouldn’t even think of like the sun or altitude.

Language Post

When I was unable to use symbolic language, like no speaking or typing, I found it to be difficult. I had to keep thinking of new ways to convey certain emotions and phrases I wanted to say.My partner had to do all of the talking, and he tried to ask me yes/no questions so we could still have a conversation. Instead of asking how work went for me, he asked if work was hard or long or good or bad. He was laughing a lot because it was weird that I wasn't being vocal in the conversation, and couldn't contribute to the flow of the conversation at all either. I had to depend on him to do all the talking and communicating. The culture who uses symbolic language has the advantage in communicating complex ideas. The speaking culture might think the other culture is less intelligent since they use only physical embellishments to communicate instead of voice, which is simpler. Some individuals in our culture who have difficulty communicating with spoken language are mute people, deaf people, people with brain damage after accidents, and people with mental disabilities. It affects how these individuals interact with others because they have to use physical actions instead of just talking to communicate. They use sign language with their hands, motions, pointing, writing, or voice output communication aids. Therefore, they have to work twice as hard to communicate in very creative ways.I was not able to last the full 15 minutes of communicating without any physical embellishments. It made it difficult because once I could no longer use vocal intonation, I would think to turn to signals, or body movements to convey what I wanted to say. Therefore, I had to think of even more clever ways to communicate. It was also hard to keep a monotone voice and not change my vocal intonation. My partner found it amusing with the way I was talking. I was talking to my boyfriend, and he showed me a picture of us on his phone and instead of me smiling and being like "Awe!", I had to say, "Awe. That's. so. cute." completely emotionless. It made it difficult for him to figure out how I felt because I was expressionless. He didn't know if I was tired, or bored or didn't want to talk to him, which was kind of funny. This experiment clearly exemplifies that non-speech language techniques are almost essential in our ability to communicate effectively. It is impossible to tell what someone feels if they do not convey emotion. Saying "I love you" with no vocal intonation wouldn't be meaningful. Saying "I love you" with a gentle, loving tone and perhaps a hug conveys so much more. Therefore, non-speech language techniques bring to life feeling and emotion, and bring meaning to a conversation.
There are definitely some people who have difficulty reading body language. Knowing how to read body language is an important adaptive benefit because it can save you from bad, uncomfortable, and avoid-worthy situations. For example, if you are walking along the street and see a dog coming towards you with narrowed eyes, showing their teeth, and anxious, as if they're ready to pounce, if you understood their body language, you would run the other way. If you didn't know, you might try to pet the dog or get closer, and end up getting bitten and/or attacked. An environmental condition where there could be a benefit to not read body language is in a classroom. Some students who cross their arms, wear their sweatshirt hoods, refuse to make eye contact, or look down may be some of the brightest students in the class. They just might not like speaking to the entire class, or are very shy. By not reading their body language and calling on them, you might be shocked by the fact that they are in tune with the class, and do have something thoughtful to say. The same goes with people who are exhibiting those same shy/reserved body languages. Talking to someone like that could make their day. Maybe they're too shy to make friends or initiate a conversation, but by talking to them, they could gain a new friend. Another environmental condition where it would be beneficial to not read body language would be if a band was performing to a crowd of people who look bored. If the band pays attention to the body language, they might get upset or angry and stop trying very hard. If they push through and focus on putting on the best show ever and remain positive, they could gain fans. Plus, Some bored looking fans may just be too exhausted to rock out.

Piltdown Hoax

In early 1912, a laborer found a piece of skull when he was digging at Barkham Manor near the village of Piltdown in England. He then passed it on to amateur archaeologist, Charles Dawson, who passed on the news of discovering a part of a human skull to geologist, Sir Arthur Smith Woodward. Dawson claimed that the skull would “rival the German’s ape man”. After a summer of digging, they found an ape-like jawbone with human-like teeth, which seemed to connect to the skull Dawson had been given. The discovery was announced on December 18, 1912, named Piltdown Man or “the earliest Englishman”. It was accepted by the general public as it was proof of Charles Darwin’s theory that humans were connected to apes. It was proof of the earliest human. However, some scientist questioned its validity because part of the jaw was broken off, so there was no way to show if the jawbone truly fit the piece of skull. The canine tooth was absent. A year later, a canine tooth was miraculously found, which silenced those who were doubtful. This discovery was aided by Dawson, Woodward and priest, Teilhard de Chardin. The Natural History Museum and even Winston Churchill backed these discoveries. In 1953, the Piltdown hoax was announced. In the museum, Kenneth Oakley did a test to authenticate and date the fossils, which showed that Piltdown Man was much younger than expected. In the mineral department, tests were carried out to estimate the nitrogen content, which revealed that the skull had been stained and the teeth had been filed down. It was an old ape jawbone. The fossils were boiled and stained with chemicals to give them an aged look. The canine was filed and painted. There were several suspects who could have been responsible for the hoax. Conan Doyle, who created Sherlock Holmes, lived close to Piltdown and was in the same social circle as Dawson. He told Dawson he was excited about his finds, but scientists mocked him for his photographs of “spirits”, which made him upset. In his book, The Lost World, many things he wrote were parallel to the story such as saying “a bone can be as easily faked as a photograph”. He never admitted because he was engaged in political talk and trying to influence the British government in the conduct of war, so that would have been the wrong time to talk about such a thing. Charles Dawson is an obvious suspect, and had a personality of getting everything he went after. Other artifacts he claimed to discover were also fake. Woodward was Dawson’s number one supporter, but he didn’t even test the jaw for nitrogen content or spot signs of forgery like the filed teeth, even though he was the most eminent scientist at the museum. Martin Hinton, head of the paleontology department, was always skeptical of the Piltdown’s authenticity and some found stained and colored bones in an old one of his trunks, which looked similar to the staining and coloring of the Piltdown finds. Kenneth Oakley, who took part in discovering the hoax was also accused. He believed Martin Hinton was the one behind the hoax. Charles Dawson longed to find the first Englishman, since other countries such as France and Germany had long before discovered their early men. Things such as “egotism, pride, ambition and rivalry” can affect scientific judgments. Furthermore, those behind the Piltdown find did not take a close look at what they found or do tests on them to see if they were authentic or what they claimed to be. If they had spent more time analyzing what they found, or just holding up a magnifying glass to the teeth or bones, instead of jumping to conclusions, they would have been able to tell it wasn’t what they thought it was. Also, the fact that the hoax was not discovered earlier shows that other scientists removed from the situation did not try to verify their findings, they simply decided to accept them or at least many did. It took over 40 years for them to have enough doubt to investigate it throughougly, which is a huge flaw. As I said above, on behalf of the Natural History Museum, tests were carried out to estimate the nitrogen content, which revealed that the skull had been stained and the teeth were filed down. Kenneth Oakley did a nitrogen test, to authenticate and date the fossils which showed that Piltdown man was far younger than he was supposed to be. They also discovered that the fossils were boiled and stained with chemicals to make them look older. Even by using a magnify glass, Dawson could have seen the teeth were filed down. Therefore, the technology and investigation of scientists showed the positive aspects of the scientific process, exemplifying how talented and observant such scientists can be. It is not possible to remove the human factor from science, because a human has to interpret data and finding. Science is not only findings and research. It is connecting those findings and discoveries to other ideas and concepts and theories. Charles Darwin’s natural selection theory grew off of other scientists’ findings and discoveries, as well as other scientists’ theories and ideas. We can’t learn about the world simply by looking at a bone, we need professionals to analyze it and connect it to other ideas. There will always be chances in error, which is why every scientific idea is called a theory- it cannot be proven. I would not want to remove the human factor from science as I believe it is essential. If every theory is looked into thoroughly before it becomes a huge idea that people set as a basis for other ideas, then we will decrease chances for error like the Piltdown man hoax. This historical event shows that you should never be so gullible as to accept such huge information or ideas from unverified sources. You need to thoroughly investigate everything if such a huge idea is presented. Scientists mainly stayed quiet, even the Museum, instead of looking into the discovery from the beginning when people were having doubts. It doesn’t matter if you have many credible geologists on your side, there is no harm in questioning and verifying facts before deciding that if it is credible and reliable.

D.

1.Chimpanze

2.Baboon

3.Spider Monkey

4.Gibbon

5.Lemur

A.Environment

Lemurs: Lemurs still are native to the country Madagascar they also live in other parts of islands surrounding Madagascar. Lemurs prefer to live in the canopy tree tops of the tropical rain forest. Lemurs are the only mammals that inhabit Madagascar so they have no predator except for farmers where clear lands. The Lemurs communities’ diversity and complexity increases with floral diversity and precipitation, the lemurs feed on the flowers and insects and leaves that inhabit lemur’s environment. Lemurs spend most of their time in trees or bushes. Lemurs that stay awake during the day live in groups and nocturnal lemurs prefer to live alone.

Spider Monkey: Spider monkeys live in the tropical rainforests of Southern and Central America, from Southern Mexico to Brazil. Spider monkeys prefer to live in large tracts of moist evergreen forests and they require an undisturbed primary forest. They live in the upper layers of the rainforest and roam the high canopies of the rainforest. Spider monkeys spend most of their times up on trees so they are well adjusted to the life in the treetops of the rainforest. These monkeys are strong and agile and can find food with the resources that are within their environment. Spider monkeys are rarely seen on the ground do to natural predators that roam the grounds of the rainforest

Baboon: Baboons can be found in Africa. Baboons prey on fish, birds, and small antelope. They also feed on leaves and other vegetation that inhibit there island. Like any other mammals Baboons require water and can adapt to their environment as long as water and vegetation is close by. Baboons live in tall trees or on cliff faces.

Gibbons: Gibbons live in subtropical rainforests from northeast India to Indonesia and north to southern China, including the islands of Sumatra, Borneo, and Java. Gibbons move from tree to tree by swinging their arms between branches. Gibbons prefer to live high up in the trees keeping them safe from natural predators. The male and female gibbons sleep in separate trees. Gibbons are known to sing throughout the day unless they are sleeping.

Chimpanzee: Chimpanzees are able to live in all different types of habitats. They are known to be adaptable to all types of environments so in a way they are the closest mammals related to humans. Chimpanzees live both in trees and on the ground and live in large groups are some chose to be in smaller groups.


Answer B: Locomotor Patterns

Lemurs: lemurs are well known leapers they leapt from about 3 meters from tree branch to tree branch and climb up trees well also. Lemurs are able to walk on all four limbs making them quadruple.

Spider Monkey: There are different types of locomotion that spider monkeys use. The spider monkey uses all four limbs for locomotion as seen while walking or running. They use suspensory locomotion which is the type of locomotion that enables them to use their tails, to climb or to move throughout the trees. Since spider monkeys spend most of their times in trees there body is very acrobatic and they are able to move swiftly through tree tops.

Baboon: Baboons have a quadruple type of locomotion pattern locomotion pattern. Their locomotion pattern is different from other types of monkey these baboons walk on their digits or in other words they walk on their toes with the heels not touching the ground. This type of locomotion is known as digitigrade quadruple.

Gibbon: Gibbons main locomotion pattern is brachiating. When gibbons brachiate, they use four fingers of their hands like a hook, they use there hook like hands to swing from tree to tree. These types of monkeys have long s arms due to always swing from tree to tree. Gibbons are also known for being acrobatic just like the spider monkey. Gibbons lives are spent mainly in the trees. And just like the spider monkey gibbons prefer to live high up in trees due to natural predators that inhabit the ground beneath. Rarely are gibbons seen to be on the ground but when they are seen on the ground they walk on two legs. Gibbons are capable of walking along trees on their feet they use their arms as a type of balance to keep them steady preventing them from falling

Chimpanzee: the Chimpanzee is usually seen walking on all four limbs, and they are also capable of walking upright. Chimpanzees walk on the soles of their feet and the knuckles of their hands, this is also known as knuckle walking. Chimpanzees will naturally walk on their feet when they need to use their arms to carry something. Chimpanzees are also capable of brachiating so they are also able ability to swing from branch to branch in the trees.

C.
For the Spider Monkey and the Gibbon, I would say that the way they move locomotor patterns was influenced by the primates environment greatly. If these three primates were not able to hang from a tree or able to swing from branch to branch and had to walk on the ground they would be more prone to being eaten by a bigger predator. With the ability to hang from the trees and swing from the branches they are able to stay up in the high trees and keep themselves safe from the predators on the ground.

For the Chimpanzee I would say that the locomotion trait has been adapted to the environment. Chimpanzees are primates that can adapt to their environment really quickly. The way they move adjust to where they are living. Chimpanzee’s are able to walk on all fours or if they need to carry food or something else they are able to walk on two of their limbs. Chimpanzees are also able to climb trees and suspend themselves from branches. I think the chimpanzees locomotion trait works to their advantage sine they are able to adapt easily to any environment that they are in.

Baboons walk on all fours and their digits which is the tips of their toes and the knuckles of their hands. This locomotion trait I believe was adapted to help the baboons keep their hands and the soles of their feet from becoming to rough since they are not able to climb trees or hang from branches.

Lemurs adapted to their environment rather well. Since they are either on the ground or in the trees the locomotion movement of Lemurs has adapted well to their environment. They are able to move on the ground rather quickly and if need be can leap into the trees and have great balance.


I would say that the influence the environment has on physical and behavioral traits has a huge impact. I say this because we adapt to whatever situation or wherever we are so that we are compatible with what we are doing. I believe the same is for primates. The primates adapted to the environment that they were dealt. Some primates got pushed out of their natural environment and was relocated to a new one. With the new environment comes new issues, such as types of food, shelter, and the make up of the ground. The primates learned how to walk to keep their feet and hands from becoming to rough and other primates figured out how to leap into the higher trees or keep their balance on a slimmer tree branch. The environment impacts our traits immensely.

Analogy/ Homology On Dog's And Cat's Paw's

2D

1D

A.Two different species that possesses a homologus trait are a dog and a cat each of these mammals possess a trait of a paw.

B. Each of these animals possesses homologous trait of a paw, both a dog and a cat have many differences in structures. each come from a different species the cat comes from the feline species and the dog comes from the canine species but each of these species posseses a simlair trait and that is the trait of having a paw. Each of these animals have a different body structure the dog is bigger and is more muscular and broader and a cat is more flexible and narrow which enables it to get through small places. Each of these animals possess the same trait but uses it for different purposes for instance a dog uses a paw to dig up dirt and also to run and also use there paw as a defense or attack upon other animals, a cat uses there paws to climb up things such as tree’s and high places.

C The ancestors of the cat were traced back mostly through the teeth of fossils. The first creatures had sharp teeth and looked like little wolves. These Carwora were fierce hunters of small rodents They probabaly pranced like a horse, ate like a hog, had eyes like a dog and brooded like a buffalo. All those animals had the same ancestor, Artorcyon.

A.Two different species that possesses a homologus trait are a dog and a cat each of these mammals possess a trait of a paw.

B. Each of these animals has similarities in structure for instance they each have limbs, paws and tail.They both have fur, whiskers, eyes, ears, etc.When broken down each of these animals skeleton structure of a paw is very similar. Each of these animals uses there paws for similar reasons for example to dig, to attack and to also run and walk, etc.

C. Each of these species has a common ancestor an example of this might be an animal that was called the Artorcyon. And if we go far enough back in time we would fine one common ancestor between the dog and the cat but at one point in time at particular trait called to different species to emerge now knows as the feline species and the canine species. Now this common ancestor of these two species possessed an analogous trait called the paw and this goes to show the all pairs of organisms share some common ancestor if you go back far enough in time.

Protein Synthesis

HAVE FUN FIGURING IT OUT(:

TACCAAGTGCAAGGGAACGTCTGAACAACTGAATATAACGGCTTGATC

Thomas Malthus

1. Out of the five contmeporary individuals I would argue that the most influential person to the development of Darwin's theory of natural selection would have to be the english economist by the named of Thomas Malthus.

2. Thomas Malthus wrote an "Essay on the principals of population". This important essay enormously influenced Charles Darwin. Malthus wrote about the struggle for survival and its relationships by stating the food supply is limited, but animals will continue to breed until there are too many for the available food. At which there are too many for the available food. Which they will continue to breed until there are too many for the available food. At time they will compete for resources to survive. Darwin started thinking about natural selection, how it should be the characteristics of the survivors through succeeding generations, how this could account for the diversity among the species and their evolution over periods of time.Darwin framed Malthus work in natural terms both in outcome and it's ultimate reason.

http://www.ucmp.berkeley.edu/history/malthus.html

3. I have two points I believe influnced and affected Darwin in many ways. The first one was the

-Resources are limited. Our planet has a limit of much it can hold and produce. There will not be enough resources available for all organisms to reproduce as many offspring as they can." As mentioned in the book the important fact is that when population is limited by resource availability there must be competition for food, water.Malthus argued that the lack of resources would always be a constant source of “misery” and famine from humankind if our numbers keep continuing to increase.

-Organisms with better access to resources will be more successful in their reproductive efforts. The rabbits with more food and water and shelter will reproduce more offspring than those rabbits with fewer of these resources. As mentioned in the book Darwin hypothesized that organisms with traits that were better adapted to their environment would have greater reproductive success because those traits allowed them to be more competitive for the things they needed to reproduce.

4.I believed Darwin’s theory of natural selection could not be developed without the influence and ideas of Thomas Malthus. Thomas Malthus enormously influenced Charles Darwin, because he was arguing for limits to human population, growth. If population size increases exponentially while food supplies remain relatively stable. Darwin recognized the important fact that when population size is limited by resource availability, that there will always be competition for food.And competition between individuals is the main point to understanding natural selection.

5. The attitude of the church, public opinion was negative.Darwin slow downed on the procces of publishing his book “On the origin of species” because he was hesitant by the church because Darwin knew it will also be a controversy to many people. Those who believe in an absolutely literal interepretation of the bible accept no compromise. Religion and science concern different aspects of the human experience, and they aren’t inherently mutually exclusive approaches. Darwin was also troubled by his wife emma she saw his ideas as running counter to her strong religious convictions.